HTTPS://SHOP.SOLEXNATION.COM/DRGRANT[BECOME QUANTUMWELLNESS ADVOCATE]ONLY $495. FULL TRAINING & CERTIFICATION PROVIDED FOR ONLY $249 [3 VIRTUAL TRAINING HOURS].

DOWNLOAD THE SOFTWARE ON YOUR COMPUTERFREEFOR ONLY $149 MONTHLY SUBSCRIPTION.

https://www.youtube.com/@SolexLLC

Read More

“An investment in knowledge pays the best interest”

If you think Retreats are Expensive, Try to take No Vacations?

If you think Wellness is Expensive; Try Illness?

If you think Education is Expensive; Try Ignorance? The Choice is YOURS!

As a reminder, here are the five types of foods you should avoid, or at least minimize, to speed the healing process:
 

1. Bagels, Muffins, Pastas, Breads (white or wheat), etc. Virtually all of these use wheat that has to some degree been tampered with by man over the past several decades. Specifically, I mean they use genetically modified organisms (GMO). On top of the fact that you are eating a genetically modified ingredient, these foods are for the most part empty calories, offering little nutritional value. Finally, the small protein called gluten present in these foods often affects our bodies in unexpected ways through our gut. It’s best to minimize gluten intake whether you know you are sensitive to gluten or not.
    
2. Processed Foods, or what I like to call “Food Product.” For the most part anything that comes in a box or bag with a multitude of ingredients is a food product lacking the nutrition needed to heal your body. In fact, most ingredients you’ll find included in these products fall somewhere between empty matter and toxic slug. Best to just avoid all together.
    
3. Blackened or Charred. Foods cooked at high heat have a byproduct called Advanced Glycation End products (AGEs). Studies have shown that elevated AGEs can accumulate in your body over time with an adverse effect on many of your bodily systems. If you wish to overcome arthritis pain, avoid foods cooked at high temps for a majority of your meals. Personally, I love a good barbecue, but I’m careful not to overcook or burn the meat. Since I eat clean most of the time and take Heal-n-Soothe, I find it’s okay to indulge sometimes.

4. Nightshades. The term nightshades may be one of the most misunderstood concepts in nutrition today. Vegetables from the nightshade family have trace amounts of naturally occurring chemical compounds called alkaloids. These pose very little risk for the average healthy adult, but if you have an autoimmune disorder or your digestive system issues these alkaloids should be avoided or minimized for optimal health.
    
5. Sugar. Let’s be clear, sugar is sugar regardless of how you sell it. There are simple sugars called monosaccharides including glucose, dextrose, fructose and galactose. Then there are disaccharides, or compound sugars, where two monosaccharide molecules merge. Those include lactose, maltose and sucrose. They are all sweet. And they are all oxidative in excess amounts. With continued oxidative action, your body will trigger an immune response which keeps your body in an inflamed state. In short, if your body must constantly work to process sugars over a long period of time, your body will become stuck in this inflamed state, never giving your body a break long enough for it to advance to the next stage of healing.

Of the five worst foods, I firmly believe sugar is the worst of them all because it is found in virtually everything and we simply eat too much of it on a daily and weekly basis.

I know it can be hard to change your dietary habits, so instead of asking you to stop eating sugar, let me ask you to simply look at the nutritional facts label on the food you eat and just try to gauge your daily intake for now.

The American Heart Association indicated men can have up to 37 grams, or 9 teaspoons, a day and women can have up to 25 grams, or 6 teaspoons a day. Use that as a guideline and goal.

Breakfast is the most important meal. Eat a healthy breakfast high in protein and high in fiber with no sugar or flour. Eat breakfast like a king/queen; Lunch like a prince/princess and supper like a popper.
When your blood sugar goes up quickly and stays there, insulin rises in response, chasing that excess sugar around the bloodstream and shoving it into any cell that will take it, which is more often than not the fat cells.
This effectively turns off your fat-burning switch, which is glucagon, a hormone that has the exact opposite effect of insulin.
If you want to burn belly fat, you will want your fat-burning switch to be turned on. This can not happen when insulin levels are high. So you want a breakfast that does not send insulin levels skyrocketing. It is that simple.

Lets take a closer look at 19 of the balancing benefits of water, lemon, and salt, all in one cup.

Lemons are excellent for fighting inflammation. Lemons can help dissolve the uric acid in your joints, and also have been found to help build and repair tendons, ligaments, and bone. This anti-inflammatory property may be especially beneficial for people with rheumatoid arthritis and osteoarthritis, according to an American College of Physicians study on osteoarthritis, published in the Annals of Internal Medicine (2000).

Aids in proper food and water absorption. A daily glass of lemon water with Himalayan salt may provide a better overall mineral balance, which promotes proper food and water absorption in your body, allowing essential nutrients to get where they need to be.

Balances your body’s acidity (pH). The alkalizing effects of lemon and natural salt are highly useful for managing your body’s delicate pH balance, which is crucial for optimal functioning of the body’s systems.

Boosts immune function. One lemon serves up 139 percent of your daily value (DV) for vitamin C. Squeezing one lemon into your morning is a natural alternative to that vitamin C supplement you may be taking.

Its a detox for your cells. The all-natural Himalayan salt mixed with lemon juice and water helps to pull toxins from your cells, reducing cellular toxicity. This may reduce your risk for various chronic diseases, as well as make you feel generally awesome!

Reduces problematic cellulite. Natural salts like Himalayan salt have been used for centuries for skin care. Interestingly, most spa treatments for cellulitis contain some form of salt and/or citrus blend. A few daily gulps of lemon and salt water in the morning may firm up a few of those unsightly areas.

Clears up skin and adds a fresh glow. Using natural salt for skin problems, such as psoriasis and eczema, dates back to ancient Roman times. Roman emperor Marcus Aurelius doctor, Galen from Pergamum, used sea salt for skin diseases, according to Science Tribune (1999).

glass of water with lemon
Useful for allergy season. It has been suggested that the combination of lemon and salt, specifically mixed into warm water, acts as a natural antihistamine for allergies. It may be the perfect alternative to those pink pills that leave you feeling drowsy.

Paves the way for better sleep. The natural hormone-balancing properties of lemon and Himalayan salt can be more than useful when it comes to bedtime. Getting the proper amount of sleep is essential for physical health, mental health, productivity, and much more. This hormone-balancing beverage can make an effective nightcap.

Helps controls blood sugar. The fiber content of lemons helps to balance blood glucose levels, which is useful for type 2 diabetes patients and prediabetics alike, according to a study published in the New England Journal of Medicine (2000).

Lemons may help detoxify your liver. Vitamin C is essential for producing glutathione, which plays a foundationa role in detoxifying the liver. It also has antiseptic properties that are useful for liver function, as well.

Freshens breath! Lemon and Himalayan salt may not be the first things that come to mind when you think of fresh breath. However, the lemon and salt in this simple morning drink help kill the bad breath bacteria that build up while you are sleeping.

May help you chill out. When you get stressed out, do not be so quick to reach for those prescription pills. You may be able to chill out and return to that state of Zen by boosting your vitamin C levels first thing in the morning.

Useful for reducing blood pressure. Lemons are not all about vitamin C and fiber. They also boast potassium, which is vital for flushing excessive sodium from the body.

Boost your libido! The vitamin C content and hormone-balancing properties of this morning beverage can help lift your mood. This might be all it takes to boost your libido, without the need for that little blue pill.

Gets you hydrated right out of the gate. Many people forget how important hydration is, especially after a seven or eight-hour sleep period with no water. Start your morning off right and get hydrated. The water, salt and zesty lemon will get your day off to the perfect start.

An antioxidant powerhouse vital for, well, everything! Lemon offers up a wealth of vitamins and minerals, while Himalayan salt boosts your mineral and trace mineral levels even more. The antioxidant and detoxifying properties of lemon saltwater pack a powerful, free radical knockout punch.

May improve your heart health. Lemons and real salt are both exceptional for increasing heart health on their own. However, when you combine the two into one vibrant morning drink, you get even more vital heart-thumping health benefits.

Natural salt supports electrochemical reactions in the body, while negative ions assist in healthy heart rhythm. Lemons are rich in vitamin C, which is, associated with lower endothelial dysfunction in men with no history of cardiovascular disease or diabetes, according to a study published in the American Journal of Clinical Nutrition (2006).

Promotes digestive health. A glass of warm lemon water with Himalayan salt before breakfast, or any meal, helps signal your liver to produce the essential bile needed to clean out harmful gut bacteria. The fiber content and natural salt will also promote digestion.

Are you ready to commit to this simple and health-promoting morning drink? I have been drinking warm lemon water with a little bit of Himalayan salt every morning for months, and I absolutely love it. My energy levels are up, and I feel as cool as a cucumber throughout the day.

Want to join me? Combine 10 ounces of filtered water with one whole lemon, squeezed, and half a teaspoon of Himalayan salt.

.

Read More

Would you like to improve your Sleep, reduce your Pain, Manage your Stress/Anxiety, reduce the dependency on Prescription & Over the Counter Medications and reverse any challenge Naturally? 

What is the connection between Migraines & Cell Phone?

Peppermint oil, says a study in Phytomedicine efficiently alleviates tension-type headaches. It causes a significant increase in blood flow to the forehead and contains analgesic (pain-relieving) properties. The combination of peppermint oil and the other oils in Migraine Care boosts brain performance while having both a muscle- and mentally-relaxing effect.

Spanish sage (salvia) improves brain function and even improves memory. Sage essential oils have been used in the treatment of a wide range of diseases such as those of the nervous system. In addition, sage essential oil has been shown to relieve spasms. Ursolic acid, a component of sage, has strong anti-inflammatory properties. According to Neurology Advisor, inflammation may play a significant role in migraines.

Cardamom contains chemicals that reduce swelling, according to WebMD. As anybody like me who has experienced the debilitating effects of migraine pain knows, it feels like your brain is swollen. Indeed, what happens when you have a migraine is that excited brain cells trigger the brain to release chemicals that irritate and cause blood vessels on the surface of the brain to swell.

Ginger has been used to cure nausea since ancient times. Many people who suffer migraine attacks experience nausea and even vomiting. Ginger helps relieve these symptoms, as well as vertigo and dizziness.

Sweet Fennel is shown in several studies to improve brain function and reduce anxiety. In fact, sweet fennel in one study was shown to reduce anxiety more effectively than the drug, diazepam. Sweet fennel is listed in the 19th edition of Pharmacology and Pharmacotherapeutics for its anxiety-relieving effects.

I recommend Taking 10,000 IU of Vit. D3 daily to prevent & recover from Migrains.

Disclaimer: This website is for educational purposes only. It is not intended to treat or diagnose any disease. Prof.  Grant is NOT a physician Nor naturopath and is not covered under OHIP. Professor Grant is NOT a member of the Ontario College of Physicians & Surgeons NOR the Naturopathic Association. His work as a Scientist and Professor is recognized in Canada, the USA, and Worldwide. The academy of wellness is not for profits organization. We do not receive funding or grants from any organization. Our work as Journal Editors for 12 Journals is Gratis. Prof. Grant worked as a senior consultant for Health Canada & FDA for 10 years.

Read More

Corona Virus COVID-19 Risks & Prevention By Professor Dr. George Grant, Ph.D. www.academyofwellness.comFormer Health Canada Consultant & Quarantine Officer 1993-2003.

Coronavirus_SARS – frequencies:

9918, 9740, 4959, 4870, 2479.5, 2435, 1394.7, 1369.6, 1239.7, 1217.5, 774.8, 760.9, 619.9, 608.7, 464.9, 456.5, 309.9, 304.4, 155, 152.2Hz.

https://rumble.com/veg3uf-canadian-doctors-speak-out.html?fbclid=IwAR1R-ZSXePHV6HKRwJItbRrMD-PaU2SnzHn4ORX9g

https://beforeitsnews.com/eu/2021/05/a-must-watch-nurse-in-halifax-breaks-her-silence-2671566.html

Integrative medicine considerations for convalescence from mild-to-moderate COVID-19 disease

Author links open overlay panelLiseAlschuler^abAnn MarieChiasson^abRandyHorwitz^abEstherSternberg^abRobertCrocker^abAndrewWeil^bcVictoriaMaizes^ab

https://www.sciencedirect.com/science/article/pii/S1550830720304171?via%3Dihub†

The genetic sequences used in PCRs to detect suspected SARS-CoV-2 and to diagnose cases of illness and death attributed to Covid-19 are present in dozens of sequences of the human genome itself and in those of about a hundred microbes. And that includes the initiators or primers, the most extensive fragments taken at random from their supposed “genome” and even the so-called “target genes” allegedly specific to the “new coronavirus”. The test is worthless and all “positive” results obtained so far should be scientifically invalidated and communicated to those affected; and if they are deceased, to their relatives. Stephen Bustin, one of the world’s leading experts on PCR, in fact says that under certain conditions anyone can test positive!

We have been warning you since March: you cannot have specific tests for a virus without knowing the components of the virus you are trying to detect. And the components cannot be known without having previously isolated/purified that virus. Since then we continue to accumulate evidence that no one has isolated SARS-CoV-2 and, more importantly, that it can never be isolated for the reasons we explained last month (read the report “Can you prove that there are pathogenic viruses?” on our website –www.dsalud.com-). And in the present report we are going to offer new data that show that RT-PCR does not detect the so called SARS-CoV-2 as it is known, but fragments of human RNA and those of numerous microbes.

We have already explained the numerous problems that RT-PCR poses, recognised by organisations or governments such as the WHO or the CDC and by prestigious international experts such as Dr. Stephen Bustin who considers both the arbitrariness of establishing criteria for results and the choice of the number of cycles to be nonsense because they can lead to anyone testing positive.

In this report we are going to add the results of a particular research we have done from the data published on the alleged SARS-CoV-2 and on the protocols endorsed by the WHO for the use of RT-PCR as well as the data corresponding to the rest of the “human coronaviruses”. And the conclusions are extremely serious: none of the seven “human coronaviruses” have actually been isolated and all the sequences of the primers of their respective PCRs as well as those of a large number of fragments of their supposed genomes are found in different areas of the human genome and in genomes of bacteria and archaea, such as these: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis and a long list of others.

We are going to explain step by step the research that has led us to such an unusual conclusion.

HAVE ANY HUMAN CORONAVIRUSES BEEN ISOLATED?

During the first half of April, when the first research we conducted indicated that SARS-CoV-2 had not been isolated and since those who claimed to have done so were relying on “isolates” of previous “human coronaviruses”, we began to do a thorough review of those claimed isolates. Specifically, we reviewed the alleged isolation work of suspected human coronaviruses 229E (said to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in 2005) and MERSCoV (in 2012). And these have been the results:

Coronavirus 229E.

Reference article: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1:190-193. January 1, 1966.

Since the authors refer to other articles to explain the method of isolation – which they call Complement Fixation – we consulted a reference article for that method: that of Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5):931-938, May 1965. This is a procedure already in disuse that uses the antigen-antibody reaction to detect either one or the other. In the case we are dealing with, the aim was to detect the antigens of the supposed new virus but, as we have already explained, specific antibodies are needed which cannot be obtained the first time a virus is detected.

Coronavirus OC43.

Reference article: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub.

What was considered to be viral RNA was extracted from cultures without any proof that the RNA belongs to a virus. The tool used – a QIAamp kit – removes reagents, inhibitors and contaminants but what it cannot do is determine where the extracted RNA comes from. And there are no controls. It is then amplified by PCR and sequenced assuming (!) that it is genetic information of a virus. Finally, the author speculates about mutations, recombinations, genotypes, molecular evolution, strains and other jargon that conveys the idea -unproven- that a “virus” is being worked with.

SARS-CoV Coronavirus.

Reference article: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.

There is no mention of purification in the article. There is not even any mention of filtration or centrifugation. It is only stated that “the viruses were isolated in fetal monkey liver cells from nasopharyngeal aspirates and lung biopsies of two patients”. There are no controls. The only mention is of a “cytopathic effect” that is attributed to a virus and that PCR was done for known viruses and retroviruses without obtaining results. Finally, RT-PCR was done with “random initiators” and a sequence “of unknown origin” is detected to which “a weak homology with the coronaviridiae family” is found. Then they designed primers for that sequence and when testing 44 samples from SARS patients only 22 were positive.

Coronavirus NL63.

Reference article: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004.

The authors state that “the identification of unknown pathogens using molecular biology tools is difficult because the target sequence is not known so that PCR-specific initiators cannot be designed”.

What they used is a tool they developed themselves called VIDISCA which, they claim, does not require prior knowledge of the sequence! Is that possible? Let’s see how it works: first the culture is prepared and it is assumed that a virus is present due to the evidence of “cytopathic effect”. The novelty introduced by this method is that “restriction enzymes” are added, enzymes that cut the nucleic acid molecules at certain locations and always by the same length. In this way, if after the action of these enzymes they observe many fragments of DNA or RNA that are the same or very similar, they deduce that it comes from a virus, since the host genome would present random cuts, while the virus genome presents a large number of copies that are the same due to the replication of the virus. And is such a deduction correct? Of course not! This assumption (which adds to the previous assumption that there is a virus) does not take into account that there are “virus-like particles”, “retrovirus-like particles”, “endogenous retroviruses”, “exosomes”, “extracellular” particles and even mitochondrial DNA. In denial, there are a multitude of particles that possess the same reproductive characteristics in large quantities as “viruses” and therefore can falsify results by producing large numbers of identical copies when cut by enzymes as recognised in an article on the VIDISCA technique entitled Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery. It was published in volume 263 of Virus Research on April 2, 2019, and its authors-Cormac M. Kinsella et al.-recognise that “no redundancy is expected in the VIDISCA insert from the host background nucleic acid except in the case of ‘virus-like’ characteristics, i.e., high copy numbers as in mitochondrial DNA.

Coronavirus HKU1.

Reference article: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005.

The article, incredibly, begins with these words: “Despite extensive research in patients with respiratory tract infections, no microbiological cause has been identified in a significant proportion of patients. RNA is extracted from non-purified cultures.” And a PCR with coronavirus genes is used. For the sequencing they use two protein databases organised in families, domains and functional sites -PFAM and INterProScan- combined with two computer programs that carry out “predictions” on how nucleotides should be combined. The text adds: “The sequences were manually assembled and edited to produce a final sequence of the viral genome”. And once again there are no controls.

MERS-CoV Coronavirus.

Reference article: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012.

The genetic material is extracted directly from the culture supernatant and sputum sample with a tool called High Puré Viral Nucleic Acid Kit and then tested with different PCRs for various known microorganisms. There is no mention of purification and there are no controls.

In short, what had been done with the first coronaviruses -and with many other supposed viruses– is to cultivate supposedly infected tissues – any “cytopathic effect” was attributed to the presence of a virus only – and then either some proteins are obtained which without any test are considered “virus antigens” and when these “antigens” are detected in cultures it is interpreted as “isolation”, or fragments of nucleic acids are extracted assuming that they belong to a virus.

We already explained in the article published in the previous issue of the magazine that according to Dr. Stefan Lanka the so-called “cytopathic effect” is actually an effect caused by the conditions of the culture itself. This is recognised for example in the article Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA published on August 15, 2017 on the website of Nature and signed by Andrea Németh and others

(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf It explains that certain substances -such as antibiotics- added to in vitro experiments can stress the cell cultures so that they generate new sequences that had not been previously detected. This had already been noticed by none other than Dr. Barbara McClintock in 1983 during her Nobel Prize lecture, as can be seen at https://www.nobelprize.org/uploads/2018/06/mcclintock-lecture.pdf

In essence, NOT ONE OF THE SEVEN SUPPOSED HUMAN CORONAVIRUS HAS REALLY BEEN ISOLATED. The only thing that has been different between them are the laboratory procedures and techniques that were becoming progressively more sophisticated which, in this case, has implied not a greater accuracy but a greater capacity for deception and self-deception that has culminated in the virtual manufacture of the SARS-CoV-2.

And the obvious consequence of the lack of evidence of its isolation is that such “coronaviruses” cannot be held responsible for any disease. Moreover, all tests – of whatever kind – based on the presumed components of these “viruses” (nucleic acids or proteins) are completely disqualified as “infection tests” and even more as “diagnostics” of diseases.

MORE UNANSWERED REQUESTS

In the previous issue we already collected the answers given by the authors of several articles that supposedly described the isolation of SARS-CoV-2 in which they acknowledged that they had not “purified” which implicitly means acknowledging that the virus was not isolated. And now we are going to add one more piece of evidence: the responses given by different authorities – political and health – from various countries about the purification and isolation of SARS-CoV-2.

James McCumiskey -author of the book The Latest Conspiracy: The Biomedical Paradigm– tells us that the National Virus Reference Laboratory of Ireland requested information about it from the University of Dublin and the latter responded that “it has no records that could provide an answer to their request”. The director of legal services of the laboratory insisted on his request to the university and the university responded as follows: “The position of the university is that material of academic debate cannot be subject to the Freedom of Information Act”. It follows from the NVR’s request that they have not cultivated SARS-CoV-2 or purified it. They only acknowledge having “detected SARS-CoV-2 RNA in diagnostic samples.”

On June 22, a group of experts sent a consultation in similar terms to British Prime Minister Boris Johnson. The letter was signed by Dr. Kevin Corbett, Piers Corbyn – professor at Imperial College London -, the engineer and independent researcher – who we interviewed in the journal at the time – David Crowe, Dr. Andrew Kaufman, the Edinburgh professor of biology Roger Watson and the biologist and chemist David Rasnick – and to this day they still have not received a reply!

Another similar request – in this case to the National Research Council of Canada – received the following response: “We have not been able to carry out a complete search of the NRC’s records so we regret to inform you that no records have been identified that respond to your request.”

We will add that two journalists have been sending similar requests – under the Freedom of Information Act – to various institutions in Canada, New Zealand, Australia, Germany, the United Kingdom and the United States, and as of September 5, twelve institutions have responded, all indicating the same thing: that they have no record of work describing the isolation of the virus that is supposed to cause Covid-19. The details and the answers can be seen at

LOOKING FOR THE ORIGIN OF THE FALSE GENOME

The question we asked ourselves then was: if the sequences that have been published do not belong – as claimed- to new viruses, where do they come from? And to try to answer that question we decided to carry out a search with a computer program called Basic Local Alignment Search Tool (BLAST), a sequence alignment search tool that allows us to compare a given sequence with all the sequences stored in the National Institutes of Health of the United States (it is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by step what we did so that our readers can repeat the search for themselves and check the results.

First we collected all the initiators of the PCRs described in the protocols hosted on the WHO website at the time which were these:

• China CDC protocol: uses ORF1ab and N genes as target.
• Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to be SARS.CoV-2 specific).
• United States CDC protocol: uses three fragments of the N gene.
• Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as target the S gene together with other genes supposedly shared with other coronaviruses.
• Charite Protocol (Germany): uses the E, N and RdRP genes.
• Hong Kong University Protocol: uses ORF1b-nsp14 and N gene.
• National Institute of Health Thailand protocol: uses the N gene.

We then introduced the sequence of the primers – the one that indicates the beginning of the sequence to be detected (forward) and the one that indicates the final (reverse) – into the BLAST so that it could search for them in two databases: a collection of microbe genomes and the one corresponding to the human genome.

THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN HUMANS AND IN NUMEROUS MICROBES!

Let’s see in detail the procedure taking as an example the initiators of the French protocol. Once on the BLAST website, we chose Microbes to search the microbial genome databases and moved to the next page. Then a form appeared in which we entered the sequence of the forward initiator of the French protocol -that is ATGAGCTTAGTCCTGTG-, we selected the option Highly similar sequences and pressed the BLAST key. Just a few seconds later the results appeared -we took a screenshot (image 1)– and we were shown 100 sequences of microbes -particularly bacteria and archaea- with a coincidence of between 77% and 100% with an identity percentage of 100%.

We then returned to the home page and that second time we chose Human to search the human genome, we repeated the same operation and after a few seconds the result appeared which we screen captured again (image 2). And it turns out that the sequence entered coincides with 74 sequences of the human genome, with a coincidence of between 66% and 100% and a percentage of identity of 100%.

And that indicates that the sequence of that initial PCR primer that is supposed to be specific to SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred microbial fragments as well!

We then decided to repeat the operation but with the final or reverse primer – which is CTCCCTTTGTGTGTGT – and the results were similar.

Since these were very short sequences -about twenty genetic letters or nucleotides- we decided to try again but with the target sequence defined by these two primers, i.e. the sequence of the supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously, for this we needed the sequence that is officially claimed to be the “SARS-CoV-2 genome” and although thousands of laboratories claim to have isolated and sequenced it -a false claim as we have explained in previous reports- we decided to go to the National Centre for Biotechnology Information website: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903. Once there, we located the “target sequence”, a fragment of 108 nucleotides located between positions 12,690 and 12,797 of the “genome”, which is this one:

ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG.

With this we repeated the steps previously described and the results were again surprising since there appeared again a hundred microbe sequences with a percentage of a match of 100% and four sequences of the human genome with an identity percentage between 83% and 95%. The matches were therefore lower but the important thing is that we continue to find fragments of the supposed “target sequence” of SARS-CoV-2 both in microbes and in our own genome.

Truly astonished we took a further step and tested with the gene considered at that time as the most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472:

ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCGATTCTGGTCTAA.

We repeated with it the steps already described and the result was even more surprising because despite its length another hundred microbe sequences appeared with a percentage of identity of 100% and 10 sequences of the human genome with a percentage of identity between 80% and 100%. And similar results were obtained with a fragment chosen at random and with the N gene which they say corresponds to the proteins of the SARS-CoV-2 nucleocapsid.

We finally decided to test with the S gene which is said to generate the structural “spike” proteins that are key to entry into the cell and was subsequently considered to be the most specific SARS-CoV-2 gene. Since it is a gene whose sequence is much longer – 3821 nucleotides between positions 21,563 and 25,384 – we tested with two fragments chosen at random within that gene and the first – TTGGCAAAATTCAAGACTCACTTTC – resulted in another hundred microbe sequences and 93 sequences of the human genome and the second – CTTGCTGCTACTAAATGCAGAGTGT – a hundred microbial sequences and 90 of the human genome.

Finally we decided to test with the initiators of the Japan Protocol, the only one that includes target sequences of the S gene and, the reader will have already guessed, the results were once

again similar: a hundred microbe sequences and 93 sequences of the human genome with an identity percentage between 94.12% and 100%!

CONCLUSIONS

The consequence of all that we have just explained is clear and immediate: THERE IS NO VALID TEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included those based on the supposed gene that codes for the S1 or spike protein. And that means that

ALL THE NUMBERS OF “CASES”, “INFECTED”, “SICK”, “Asymptomatic” OR “DEAD DUE TO COVID-19” LACK A SCIENTIFIC BASE AND ALL “POSITIVES” ARE FALSE POSITIVES, something that should be communicated immediately to those affected and those responsible should be held accountable.

We end by adding that even the WHO itself does not really believe in these tests. Just read the document published last September 11 as a laboratory guide for SARS-CoV-2 entitled Diagnostic tests for SARS-CoV-2 – it is available at https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve – and it literally says on page 5: “Whenever possible, suspected active infection should be tested with a nucleic acid amplification test (NAAT) such as RT-PCR. NAAT tests should target the SARS-CoV-2 genome but since there is no known global circulation of SARS-CoV-1 a Sarbecovirus sequence (presumed to include at least five human and animal coronaviruses including SARS-CoV-1 and SARS-Cov-2) is also a reasonable target”. That is, WHO agrees to use non-specific sequences to detect SARS-CoV-2.

That is not all because the manual later states, “An optimal diagnosis consists of a NAAT test with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used.”

The WHO manual states, “One or more negative results do not necessarily rule out SARS-CoV-2 infection. There are a number of factors that can produce a negative result in an infected individual including poor quality of the sample, late collection of the sample, inadequate handling, or technical reasons inherent in the test, such as mutation of the virus or inhibition of PCR.”

What are the judges waiting for to act on their own initiative?

Jesus Garcia Blanca

Note: the author publicly thanks Juan Pedro Aparicio Alcaraz for his patient and meticulous collaborative work in the search for scientific articles and for his tedious work with the BLAST.

THIS REPORT APPEARS IN (https://www.dsalud.com/revistas/numero-242-noviembre-2020/)

COVID-19 is a serious health threat, and the situation is evolving daily. The risk will vary between and within communities, but given the increasing number of cases in Canada, the risk to Canadians is considered high.

This does not mean that all Canadians will get the disease. It means that there is already a significant impact on our health care system. If we do not flatten the epidemic curve now, the increase of COVID-19 cases could impact health care resources available to Canadians.

We continue to reassess the public health risk based on the best available evidence as the situation evolves.

Who is most at risk

While COVID-19 can make anyone sick, some Canadians with specific health circumstances are at an increased risk of more severe outcomes, including individuals:

• aged 65 and over
• with compromised immune systems
• with underlying medical conditions

In addition, social and economic circumstances may also be a factor in identifying someone who is vulnerable to COVID-19. This includes anyone who has:

• economic barriers
• difficulty accessing transportation
• difficulty accessing medical care or health advice
• unstable employment or inflexible working conditions
• insecure, inadequate, or nonexistent housing conditions
• ongoing specialized medical care or needs specific medical supplies
• social or geographic isolation, like in remote and isolated communities
• difficulty reading, speaking, understanding or communicating
• ongoing supervision needs or support for maintaining independence
• difficulty doing preventive activities, like frequent hand washing and covering coughs and sneezes

Coronaviruses are a large family of viruses that may cause a range of illnesses in humans, from the common cold to SARS. Viruses of this family also cause a number of animal diseases.

Pandemic Coronavirus (COVID-19)

On December 31, 2019 the WHO China Country Office was informed of cases of pneumonia of unknown etiology detected in Wuhan City, Hubei Province of China. The outbreak began in a seafood and poultry market in Wuhan, a city of 11 million in central China. Like SARS and MERS-CoV, the newly detected coronavirus has a zoonotic source, however, human to human transmission has been confirmed. On March 11, 2020 the WHO declared COVID-19 viral disease a pandemic.

Epidemiology of COVID-19

As of June 10, 2020 total of 7,264,866 confirmed cases caused by the novel Coronavirus COVID-19 and 411,879 deaths were reported. At this time 188 countries are reporting cases of the novel Coronavirus. For a full listing of affected countries refer to Coronavirus (COVID-19) Global Cases (Johns Hopkins University)

Scientific Recommendations to cope with the Corona Virus COVID-19 Pandemic:

Use Natural Hand Sanitizer [Tea Tree Oil/Thyme/Colloidal Silver] and natural anti bacterial soap. Use Oregano Oil daily. Avoid toxic commercial sanitizers.

Take 8-10,000 Vitamin D3 + 5000mg Vitamin C + Vitamin A [5000IU or 1500 mcg] & 200 mcg Selenium. Methyl B Complex Vitamin. Take Bio available/Patented/Published/Proven Clinically Multivitamin/minerals/antioxidant/Probiotics to support immune system. Healthy Thymus & Gut Bacteria are essential for a Healthy Immune System. Lots of Sunshine & Fresh Air daily. Plenty of Hydration with pure alkaline water [half your body weight in OZ of water daily] 2-3 L daily. Deep Belly Breathing hourly. Sleep is essential for optimal health. See Wellness IQ section.

Professor George Grant, Ph.D. was the Scientist & Quarantine Officer with Health Canada, FDA & CDC who was in charge of SARS/MERS/Norwalk Viruses. 2002. 

Turn OFF the Radio/TV that intended to create FEAR which will SUPPRESS your Immune System. YES use common sense social isolation and natural/frequent hand washing until we build natural immunity against this virus. The Biggest Pandemic we Face today is FEAR?? It is OK to fear death; but it is FOOLISH to die from FEAR?https://www.researchgate.net/publication/316630691_Effect_of_Vitamin_D_on_ACE2_and_Vitamin_D_receptor_expression_in_rats_with_LPS-induced_acute_lung_injury

A natural way to inhibit viral replication and defeat influenza

Turmeric, Melatonin, Ozone are effective to inhibit viral replication. Quercetin, a plant pigment found in fruits and vegetables, is currently used to treat inflammatory diseases, reduce allergy symptoms and lower cholesterol and help support the immune system. Healthy Diet is a must during this time. No Comfort Foods that will cause Stress.

Common Sense Prevention, Hope instead of Fear, Positive affirmation instead of negative thoughts are highly recommended.

https://www.canada.ca/en/health-canada/services/drugs-health-products/disinfectants/covid-19/list.html?fbclid=IwAR0zua4l5wAxkxxcksVjlYXCH_HGIXMCtYAGpHomrnui-Nss60mEh46oNZY These Approved Government disinfectants/hand sanitizers are TOXIC and It can cause Respiratory Problems? That is what everyone is using against Corona Virus?? Can you explain the logic here? Do NOT use any commercial Toxic Sanitizers. Share if you care. Do your own research PLEASE.https://www.epa.gov/pesticide-registration/list-n-disinfectants-use-against-sars-cov-2

Read More